open sourceother

EvoDiff

Innovative protein sequence generation using diffusion models.

Developed by Microsoft Research

Official Site
400MParams
YesAPI Available
stableStability
1.0Version
MITLicense
PyTorchFramework
NoRuns Locally
Real-World Applications
  • Synthetic biology researchOptimized Capability
  • Bioengineering applicationsOptimized Capability
  • Drug discoveryOptimized Capability
  • Protein designOptimized Capability
Implementation Example
Example Prompt
Generate a protein sequence based on the given biological function: enzyme activity.
Model Output
"AGCTAGCTAGGCCATAGGGCCTAGCTGACCTAGC"
Advantages
  • ✓ Advanced diffusion model architecture for high-quality protein generation.
  • ✓ Open-source nature allows for extensive customization and collaboration.
  • ✓ Trained on large biological datasets ensuring high biological relevance.
Limitations
  • ✗ May require significant computational resources for training.
  • ✗ Complex model architecture can be challenging for newcomers.
  • ✗ Limited documentation on specific applications might hinder usability.
Model Intelligence & Architecture

Technical Documentation

EvoDiff is an innovative open-source AI model developed by Microsoft Research designed to generate novel protein sequences using diffusion models. It leverages advanced techniques in synthetic biology to drive breakthroughs in protein design and drug discovery.

Technical Overview

EvoDiff employs diffusion-based generative modeling to explore the vast protein sequence space. Unlike traditional sequence generation methods, diffusion models introduce noise progressively during training and learn to reverse this process, enabling the model to generate highly diverse and functional protein sequences. This approach enhances the ability to create synthetic sequences that can serve as candidates for experimental validation in bioengineering and pharmaceutical research.

Framework & Architecture

  • Framework: PyTorch
  • Architecture: Diffusion-based generative model for protein sequences
  • Parameters: Not explicitly detailed, model optimized for protein generation
  • Latest Version: 1.0

EvoDiff utilizes the PyTorch framework, offering developers flexibility and ease of customization. The diffusion architecture is tailored to capture complex patterns in protein sequence data, supporting generation of novel sequences with promising biological functions.

Key Features / Capabilities

  • Generates novel protein sequences with diffusion modeling
  • Open-source with transparent, reproducible scientific methodology
  • Optimized for synthetic biology and protein engineering
  • Supports drug discovery workflows by proposing viable protein candidates
  • Maintained and updated by Microsoft Research community
  • Accessible source code and documentation for developer integration

Use Cases

  • Synthetic biology research focusing on novel protein synthesis
  • Bioengineering applications to design functional proteins
  • Accelerating drug discovery pipelines with protein candidates
  • Exploring protein design for therapeutic and industrial purposes

Access & Licensing

EvoDiff is fully open-source under the permissive MIT License, allowing free use, modification, and commercial deployment. Developers can access the source code and resources directly on GitHub. The project encourages collaboration and contributions, supporting community-driven advancements in AI-powered protein design.

Technical Specification Sheet

FAQs

Technical Details
Architecture
Diffusion model for protein sequences
Stability
stable
Framework
PyTorch
Signup Required
No
API Available
Yes
Runs Locally
No
Release Date
2023-08-22

Best For

Researchers in bioengineering and synthetic biology fields.

Alternatives

AlphaFold, DeepFold

Pricing Summary

Free to use under the MIT license.

Compare With

EvoDiff vs DeepFoldEvoDiff vs AlphaFoldEvoDiff vs GenSeqEvoDiff vs Rosetta

Explore Tags

#protein generation

Explore Related AI Models

Discover similar models to EvoDiff

View All Models
OPEN SOURCE

BioMedLM

BioMedLM is a specialized open-source language model for biomedical applications, leveraging the capabilities of natural language processing to generate and understand clinical texts.

BioinformaticsView Details
OPEN SOURCE

ESMFold v2

ESMFold v2 is Meta AI’s second-generation protein folding model, designed for high-speed and high-accuracy structure prediction.

BioinformaticsView Details
OPEN SOURCE

Orca 2 13B

Orca 2.13 B is a large language model developed by Microsoft Research to enhance reasoning and comprehension in smaller models. It leverages synthetic training data for advanced reasoning strategies, including step-by-step deduction and self-reflection.

Natural Language ProcessingView Details